site stats

Protein curvature thylakoid 1b chloroplastic

WebbSupplementary Table S1 List of primers used in this study Sequence (5ʹ→3ʹ) Forward Reverse For RT-qPCR analysis GtCHS GTTGGGCTCACGTTTCATTT GGGTGTGCAATCCAGAAGAT GtCHI AGAGTTGTCGGATTCCGTTG GTCACCGGCAGGATTAGTGT GtF3H AAGATTGGGGGATTTTCCAG … Webb26 jan. 2024 · Thylakoid protein composition was analyzed with CURT1A-, CURT1B-, and CURT1C-specific antibodies after western blotting. Ponceau S Red staining (P.R.) was …

UniProt

Webb9 juli 2013 · We report the identification of the CURVATURE THYLAKOID1 (CURT1) protein family, conserved in plants and cyanobacteria. The four Arabidopsis thaliana CURT1 … Webb21 mars 2024 · A proteomic analysis confirmed the regulation of AtLHT1 by AtNLA (Liao et al. 2024), however, it remains to be tested whether this regulation is due to a direct interaction between AtLHT1 and the... michael jordan softball cleats https://leishenglaser.com

Protein CURVATURE THYLAKOID 1B, chloroplastic (thale cress)

WebbPTHR33222:SF3 PROTEIN CURVATURE THYLAKOID 1C, CHLOROPLASTIC 1 hit; Pfam. View protein in Pfam; PF14159 CAAD 1 hit; MobiDB. Search ... WebbInvolved in a dynamic process of vesicle-mediated thylakoid membrane biogenesis. Required for the normal organization of vesicles into mature thylakoid stacks and … WebbLOC100248815 protein CURVATURE THYLAKOID 1B, chloroplastic [ (wine grape)] Gene ID: 100248815, updated on 24-Aug-2024 Summary Other designations protein CURVATURE … how to change internet password on ring

Chloroplast proteins involved in drought stress response in …

Category:LOC100248815 protein CURVATURE THYLAKOID 1B, chloroplastic …

Tags:Protein curvature thylakoid 1b chloroplastic

Protein curvature thylakoid 1b chloroplastic

UniProt

Webbprotein CURVATURE THYLAKOID 1A, chloroplastic Cicer arietinum 28.06 0.006 2.833 metabolism tr A0A1S2Y1I5 protein PROTON GRADIENT REGULATION 5, chloroplastic Cicer arietinum 22.018 0.001 2.816 energy tr A0A1S3EIC8 eukaryotic peptide chain release factor GTP-binding subunit-like isoform X2 Cicer arietinum 7.526 0.022 2.785 energy WebbMultifaceted Roles of Plant Autophagy in Lipid and Energy Metabolism

Protein curvature thylakoid 1b chloroplastic

Did you know?

Webb9 juli 2013 · Here, we show that the CURVATURE THYLAKOID1 (CURT1) protein family, whose members are capable of forming oligomers, can induce membrane curvature in … WebbTarget Alias Description ECC score Gene Family Method Actions; AMTR_s00001p00272260: evm_27.TU.AmTr_v1... Protein CURVATURE THYLAKOID 1B, chloroplastic... 0.14

WebbGroup ID Species Protein Gene Name Bitscore info_outline Inparalog Score info_outline Seed Score info_outline Description View Group; 9778: Arabidopsis thaliana: O04616: CURT1A: 207: 1.0: 1.0: Protein Curvature Thylakoid 1A, Chloroplastic WebbLOC100824106 protein CURVATURE THYLAKOID 1B, chloroplastic [ (stiff brome)] Gene ID: 100824106, updated on 5-Apr-2024. Summary Other designations. protein …

WebbDate palm (Phoenix dactylifera) is one of the most widespread fruit crop species and can tolerate drastic environmental conditions that may not be suitable for other fruit species. Excess UV-B stress is one of the greatest concerns for date palm Webb1 okt. 2002 · Protein CURVATURE THYLAKOID 1D, chloroplastic. Gene. CURT1D. Status. UniProtKB reviewed (Swiss-Prot) Organism. Arabidopsis thaliana ... BLAST. Download. …

Webb21 mars 2024 · The molecular weight of the identified proteins ranged from 1.74 to 609.09 kDa ( Figure S1B ), where proteins of 20–30 and 30–40 kDa were the most abundant, …

WebbProtein Curvature Thylakoid 1A, Chloroplastic: 860: Arabidopsis thaliana: Q8LCA1: CURT1B: 64: 0.125-Protein Curvature Thylakoid 1B, Chloroplastic: 860: Leptolyngbya sp. … michael jordan speech todayWebb4 rader · 21 nov. 2003 · Protein. Protein CURVATURE THYLAKOID 1B, chloroplastic. Gene. CURT1B. Status. UniProtKB reviewed ... michael jordan sneaker collectionWebbLOC104783266 protein CURVATURE THYLAKOID 1B, chloroplastic [ (false flax)] Gene ID: 104783266, updated on 4-Dec-2024. Summary Other designations. protein CURVATURE ... how to change internet priority windows 10WebbProtein target information for Protein CURVATURE THYLAKOID 1B, chloroplastic (thale cress). Find diseases associated with this biological target and compounds tested … how to change internet fonts windows 10WebbThe chlorophyll a/b-binding (CAB) polypeptides are encoded by an extended family of nuclear genes. It has recently been discovered that other proteins not known to bind chlorophyll, the early light-inducible proteins (ELIPs), are also related and could be considered part of this family. michael jordan space jam action figureWebbCultivated soybean (Glycine max (L.)), the world’s most important legume crop, has high-to-moderate salt sensitivity. Being the frontier for sensing and controlling solute transport, membrane proteins could be involved in cell signaling, osmoregulation, and stress-sensing mechanisms, but their roles in abiotic stresses are still largely unknown. … how to change internet id and passwordWebb1 mars 2003 · Plastid, chloroplast thylakoid membrane 1 publication ; Multi-pass membrane protein 1 publication Note: Predominantly located in the appressed regions … how to change internet provider on ring